Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YA11FM1
Length(NT) : 529
Best Gene Model Blast : Link to GSTUMT00009761001 E-value : 1e-139
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_00571
Accession: ref|XP_368673.2| Score: 223 E_value: 4e-28
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00571 Score: 223 E_value: 2e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YA11FM1
TTGGAGAGCCTCAGTTCTGTTGCTTTAATATTCGATGAGTTCGGTGGGAA
GTTCATAATGTCCACTTTCAAAGGAATAGTTACGGAGTTTCCGGATATAA
GAATTGATTATTTTCGTCAGAGTAATGACTCGGGGGCGCGCCCGGCTCTA
GCCTGCTTTCTGACACATATCCATAGGTTTGTGAATTAAAGCAAGCTAAA
AGTCATAGAAGTGCTCTAATAGGTCTTCCATCTCTTAGCGATCATCTGCA
AGGCTTGGAAGGGTTCTACGGTGGCCCTTTCATCTATTGCTCGGCGGCTA
CTAAGGAGCTGTTGATAAAACTGGAGAGACGATTACACCGTTTTAATCTC
GCAAAAGGCGTACTTGAAGCACGGCGATGCCTTTACGCCGAGAAAGAGAA
GAAGCTTAAAGTCATCCCACTAGAAACCCCGACAATGGTTGAGATAGGAA
GTGGAAAGAGTTTACGTGTGACTCTGTTCGATGTGAGATGCTTTGGGTGC
TGTGTCGGGTAAAGCTAAAACGGTCTAGG

Sequences in the Contig:

SY0AAA58YA11FM1