Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YO19FM1
Length(NT) : 548
Best Gene Model Blast : Link to GSTUMT00003206001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04094
Accession: ref|XP_001244653.1| Score: 271 E_value: 1e-22
KEGG Definition: hypothetical protein
Accession: ang:An04g00870 Score: 253 E_value: 8e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12083|MLH3_YEAST
Gene Ontology:
GO:0032390 = Cellular component: MutLbeta complex
GO:0005515 = Molecular function: protein binding
GO:0007131 = Biological process: meiotic recombination
GO:0006298 = Biological process: mismatch repair

Sequence:
>SY0AAA57YO19FM1
TTGGGATGACGGTAATATTAGTAAGAGGGCGTGTACAGAACCGCTATCAG
AGCCCAAGGAGCCACCAGGGCCGTTTATAGAGAGTCTTCTCAGGACCTGG
GAGAACCCAGTCTTCAAACCAACAGATGCTCCAATCCCCCAGATCACTCT
TCATACCTCCGAATTTGTGCCTGGATGTGCCCACCCAACGACCAACTCAC
CGTTATTTGATGCCGCTTCGACGTTAGGAAAACTGACCAAAACGGGTCTC
CGAAATGCGGAAGTCATCTCACAAGTAGACAAGAAGTACATATTGATAAA
AATGGCTGGAATAACTACCTCCTCATCACCAGATCCGTCCGGTCTATTGG
TAATGGTAGACCAGCACGCCGCGGACGAGCGTGTTCGCGTGGAAGCATTA
TTTGCGGAACTATGCTCCCTAGAAGAGAGCCCCCAGGGAGACCAAACACG
GGCACAGAGTGGGAACCTGACATACAAAATCTCGCACAGAGAAGCAGAAC
TATTCACCCGCCACCGCGCTTCATTCTCTGAATGGAAGATACACTACA

Sequences in the Contig:

SY0AAA57YO19FM1