Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YO04FM1
Length(NT) : 459
Best Gene Model Blast : Link to GSTUMT00010651001 E-value : 1e-177
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001544839.1| Score: 422 E_value: 3e-40
KEGG Definition: regulator of Rac1, required for phagocytosis and cell migration
Accession: aor:AO090010000773 Score: 416 E_value: 6e-40
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2999 Score: 114 E_value: 5e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAA57YO04FM1
TTGGACAACTTTAAAAACCATTTGTTTTTCTGAGTATATGATACACCCTA
TTTTGCTCCCTGTTGCCACGGTATTTAGTCCTGAAAGCCTCGGTTTAGGG
ATTGTGCCCCTTTTCGTGAAATATACAGACAATAGCCTCGCACTCCAATG
GACAACATCTCAGAGCTCATTGAGAGGCTCTCAAACGATGAAGATGCTGT
TAAAAAGATGGCGGTCTTTAAGCTCCAAAGTAATATCGGGGATCCGTCGT
TTGCGGAGATATTCATAGCTCAAGGAGGACTCGCGAAGCTTCGGAAGTTG
GCATTAACGGCCAGCGGGAATACACTTGCCTACTCTCTAACGTCCTTTTC
GAGGCTTCTGGAACTCGATAAAGGGTGGGACTTTGTCAATTCCGAACTCA
TTTCACGGGTTGTGGAATTAATCGTCACACATCCTCTTGTTAATATTCTT
CGTGGCGCC

Sequences in the Contig:

SY0AAA57YO04FM1