Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YM20FM1
Length(NT) : 543
Best Gene Model Blast : Link to GSTUMT00005001001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001215388.1| Score: 419 E_value: 9e-40
KEGG Definition: hypothetical protein
Accession: ang:An04g06250 Score: 405 E_value: 2e-38
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00357|TOXA_COCCA
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0019534 = Molecular function: toxin transporter activity
GO:0006810 = Biological process: transport

Sequence:
>SY0AAA57YM20FM1
TTGGGGTTATCATAAAGAAAGAACGAAAGAGCGCAAGTCATCAACAATGA
GCCTACCATCAACGACGCCCTCACCCAGGCCAACACACCCTTCGGGTCAC
GTATTAAACAGCTAGACTGGCTCGGCACTATCCTAAACATTGGCTCCTTC
GTCTCATTGATAATGGCGATCAACTTTGGCGGAACACTCTACGAGTGGAA
CTCCTCCCAGGAAATCACTTTATTCGTCGTTGGTGGCGTCCTCATCATCG
CCTTTGGTGTGACCCAGGCGTACTCGGTCCTCACTACTCCCGCGCAGCGC
CTGTTCCCCGGCGAATTTCTTCGTGATCCGTTTTTGGTATTGCTCTTTGC
CATGATGGCGGCTGCTTCCACCGCAATCTTCGTGCCAACATATTACATAC
CGTTATACTTCCAGTTCGTCAGAGGGGATACAGCGCTTGAAGCTGCCGTG
AGATTACTACCATTCATTATTATCATGGTGGTCTTCTGTATTGTTAATGG
CGGGGCCATGTCAAAGACCGGGTATTACGCCCCCTGGTACCTC

Sequences in the Contig:

SY0AAA57YM20FM1