Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YM13FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00002118001 E-value : 1e-154
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09245
Accession: ref|XP_001551910.1| Score: 369 E_value: 7e-34
KEGG Definition: hypothetical protein
Accession: ang:An12g04500 Score: 317 E_value: 4e-28
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0206 Score: 110 E_value: 2e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAA57YM13FM1
TTGGCAGGACTTACTCCTAGATCTTGATGATCAGGGTCGCAACTATGGAA
ATCCGGGTCGCCCTCCCGCCATCTCGGAGGACGAATACGCTCACAGAGCT
TCCACTTCTTACGATGACTTTGTAGGAGGCAATTATCAGCCTTACTATGA
TGCGGATGACCAAGAGCTATATCCTGAGGAAGGCCGCCCAGCTAGTGGCT
ATCACTATGCATCTGCGAGTGATGAACAACACGATGCCGCTCACGGGAAT
GTTAGGAATAGACAACAAGGGATGGTGGAGAGAGTAAAATCAGTGCTGGG
AATGGGACCGGAATACAGCGAGATGGATTTACCGCTGACCGAAGCGCGAC
CAAAGGGTACGACTGCCGGGGGTGCAGAGGGCGCGTCCAGAGGTCGGGGG
TCAACGGAGCGACGGAGCAGTGGGAGCAAATTCAAGTTCGGTTTTGGGAG
AAGAAAAGTGGACCCATCAACGTTAGGACCGCGAGTAATTCACCTCAACA
ATCCACGAGCTAATGCTGTTGGGAAATATGTCGACAATCACATTTCTACT
GCAAAATATAACATCGCTACTTTTATCCC

Sequences in the Contig:

SY0AAA57YM13FM1