Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YL16FM1
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00011825001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 356 E_value: 3e-32
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 332 E_value: 9e-30
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>SY0AAA57YL16FM1
TTGGGTTTCCCTGGTTCTCCAGCTTATGAAAGATAGCCACGATGGCTCGG
CTGAGGAGTTTACTAACATTATCTCGACTACTCCGCGCGATTTAGCAGAA
TTTTACACTAAGATTCTTGATAGAAGCTCAGACCCCGAAAAAGCCCGACG
AATCCTACATATCGTGGTAGCAGCAGCAAGACCCCTTACCCTTACAGAAA
TGAATGTTGCATTCAGGATCACGCGGGATCACAAGTCAGTGAGAGACCCC
TCGGGAAATATTCACGATACGTTTAAAAAGACAATGAAAAATATTTGCGG
GCTTTTCGTGCGGGTTCTTGATTCGAAAATCTACCTCGTTCACCAAACCG
CGAGAGAGTTCCTCATTAAAGGATCTTTGGCTGGCCAGGGAAACTGGCAG
TATACACTGTGTCCCAAGGATTCTAACTTTGTGATTACTGACATTTGCAT
TTCTTACCTTTCACGAGAGGAGTTTGCTGGCAGCCCATTAGCAATAAACG
CTTGGGGCGGGGTTTCGAAAGAGGCGGTTGATGATTATCTTCAGAAATAC
TCCTTTCTCGATTACGCAGCCCGACACTGGGCAGATCACTTTCGAGATTC
CTTTCGACATACGGAGGATCGGGGGATGGAGTTATTCAACTTTACGCGA

Sequences in the Contig:

SY0AAA57YL16FM1