Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YK08FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00001688001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_00081
Accession: ref|XP_001790777.1| Score: 377 E_value: 1e-34
KEGG Definition: hypothetical protein
Accession: ncr:NCU05653.1 Score: 302 E_value: 3e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0382 Score: 119 E_value: 3e-07
PFAM Definition: Carb_anhydrase, Eukaryotic-type carbonic anhydrase..
Pfam Number: pfam00194 Score: 115 E_value: 7e-07
Swissprot: Q6DAJ6|CAH_ERWCT

Sequence:
>SY0AAA57YK08FM1
TTGGGGGGTTTTTGGCTTCCTTCGTTTGCTTCCTCTTTCACCTTTCCTTG
TATTTCATTTCTCGAAACCGGCTGTGCCTTGGTTACCTGTTTCTTCAAGT
CGACAGCAGGCACTTGTCTTTTGTTTCCTTTCAATTCTTCGTTTCCTCCC
TCATATCTCTTTTGTCCAAATTCCAGCAGCCGGCCCTGCAATCCCCAGCA
AAGATGTATACACAACAATTGGTTTTTGTTGCGGCAGCGCTCTCTGCTCC
GATCCTCTCCTCGGCGAATTGTATGTACGGGACGAGTCTGTTCCCTCGTG
CCGAAGGCGCCACTGTTGAGGTCTCGAACTTTGGGTATGTGGGGCTTCAG
GGCCCTCTCAACTGGGCAGCACTCTCTGCGGAGAACTCTGCTTGTGCAAC
TTCAAAAGTGCAGTCACCCATAAACATCGATAGTACCATCCAGCTCGCGC
AGGAAGCTCCAAAAATGGTTATTAAAGACGTGGAGGCGGCGGAGTTCGAG
AACCTGGGGACAACCGTGGAGGTCATTTGCAATGGTACAACAACTTTCGG
CGGAAAGGACTTCAGCTTGCAGCAATTCCATTTCCACACGCCGAGTGAGC
ATAGAGTTGCTGAGGAGTATTTTCCATTGGAGATACATATGGTTCACGAA
GCTGCAGACGGATCC

Sequences in the Contig:

SY0AAA57YK08FM1