Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YJ19FM1
Length(NT) : 516
Best Gene Model Blast : Link to GSTUMT00001743001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05477
Accession: ref|XP_001246036.1| Score: 644 E_value: 6e-66
KEGG Definition: translation elongation factor eEF-3, putative; K03235 elongation factor EF-3
Accession: afm:AFUA_7G05660 Score: 619 E_value: 3e-63
KOG Definition:
Classification: [Amino acid transport and metabolism, Translation, ribosomal structure and biogenesis].
Kog Number: KOG0062 Score: 470 E_value: 4e-48
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 274 E_value: 2e-25
Swissprot: P16521|EF3A_YEAST
Gene Ontology:
GO:0005840 = Cellular component: ribosome
GO:0005515 = Molecular function: protein binding
GO:0003746 = Molecular function: translation elongation factor activity
GO:0006414 = Biological process: translational elongation

Sequence:
>SY0AAA57YJ19FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTTGCTGAACCAGACCCATCTACGATTAAAGAGAGGCCAGCGT
TATGGTCTTTGTGGACCCAATGGCTCCGGAAAGTCCACCCTCATGCGCGC
TATCAACAACGAGCAGGTTGAGGGCTTCCCCAAGAAGACCGAAGTCAAAA
CTGTGTTCGTTGAGCACGATCTCGATTCTGCTGATACCGAGAAGACCGTC
GTCGGATGGACATTCGATAAGCTCGCCGAGACTGGTGCTGGTGTTTCCGT
TGAGGACATCAAGACTAAGTTGGGTGAATTCGGTTTCCAGGAGACCATGT
TTGATGCTCCTATCACTTCCCTTTCCGGTGGTTGGAAGATGAAGTTGGCC
CTTGCCCGTGCTGTGTTCGAGAACCCCGATATTCTTCTCCTGGATGAGCC
TACCAACCACATGGACAGACAGAATGTCAAGTGGCTCGAGCAATATTTGA
TCAACTCTCCTTGCAC

Sequences in the Contig:

SY0AAA57YJ19FM1