Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YJ16FM1
Length(NT) : 504
Best Gene Model Blast : Link to GSTUMT00007537001 E-value : 4e-81
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_366351.1| Score: 186 E_value: 8e-19
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g117 Score: 186 E_value: 4e-19
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0524 Score: 198 E_value: 1e-16
PFAM Definition: Transket_pyr, Transketolase, pyrimidine binding domain. This family includes transketolase enzymes, pyruvate dehydrogenases, and branched chain alpha-keto acid decarboxylases..
Pfam Number: pfam02779 Score: 107 E_value: 4e-06
Swissprot: P32473|ODPB_YEAST
Gene Ontology:
GO:0042645 = Cellular component: mitochondrial nucleoid
GO:0005967 = Cellular component: mitochondrial pyruvate dehydrogenase complex
GO:0004739 = Molecular function: pyruvate dehydrogenase (acetyl-transferring) activity
GO:0006090 = Biological process: pyruvate metabolic process

Sequence:
>SY0AAA57YJ16FM1
TTCCACCATCTCCCTCCTCCGACTTGATACCCGGCATCTGTTTACCGCTA
CCTAAAACATTATCACCAGCATGTTTGTAGCTAGGAATTTCCTTTCCCGC
GCTGCCGGAAATGCTCTCAGAAAGCCCCTTGTCAACATACACCGAGTAAC
TGCTTTTCAAGCTTTGAAGGCAGAGCAAAAAAATTATTCCACTGGCGGTA
CGAGAGATTATACGGTAAGGGAGGCTCTGAACGAGGCGCTTGGTATGTTG
CTCCTCGAAATTGTTGAATTGTGTTGTGTTGGGGTTGCCCCCACTAACGA
CTTCCACCAGCCGAGGAATTGGAGAGGGACGAGAAAGTACTTATTATGGG
CGAAGAAGTGGCCCAGTACAATGGGGCTTACAAAGTCACCAAGGGATTGT
TGGATCGTTTTGGCGAAAAGAGAGTTATCGATTCGCCGTAAGTTTTCTGG
CGTGAGTTTATGAGAGGATATGCTAACCTTACCTAAAGAATTACGGAGCA
CGGT

Sequences in the Contig:

SY0AAA57YJ16FM1