Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YI15FM1
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00001086001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: GTP cyclohydrolase I
Accession: ref|XP_001242620.1| Score: 427 E_value: 1e-47
KEGG Definition: hypothetical protein
Accession: ang:An09g05310 Score: 431 E_value: 1e-47
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2698 Score: 458 E_value: 1e-46
PFAM Definition: GTP_cyclohydroI, GTP cyclohydrolase I. This family includes GTP cyclohydrolase enzymes and a family of related bacterial proteins..
Pfam Number: pfam01227 Score: 174 E_value: 9e-14
Swissprot: P51599|GCH1_NEUCR

Sequence:
>SY0AAA57YI15FM1
TTGGCCCACCAATAAACACGGACCAGCTAACCAACCAAATCGATCACCGT
GTGTTCCGGATCCGTGAGAATGGAGGCCCCGCAAACGATATCGTGCCGAC
CGAATCTACCACTAATCAGCGAAGGCGGACGTCCATTGCTTTGGCTCTTG
GCGATGCGCACCCCCGCGCAGAACTGGAGGCTTCGAGACGGCAGTTCGTT
GATTATGACGGATTGTCGTGGCCGAGTATCTTGTTCGGGCACGAGGGAAA
GGTTAGAAGCTACGCCAGCCGAGGCGGAAGCTAGGCTTGAGAAGTTGTCT
GGGGCCGTATAGAATTAGGACGATACTAGAATGTATTGGCGAAGACCCCG
ACCGCGAGGGTCTCCTAGAGACACCCTCCCGATACGCAAAAGCGATGCTA
TACTTCACGAAAGGTTACGAGGAGAACCTCAAGCTAATCATCAATAACGC
CGTTTTCCGGGAAGACCACGACGAAATGGTAATAGTCAAAGACATTGAAA
TCTACTCCATGTGCGAACACCACCTGGTCCCTTTCACCGGGAAGATGCAC
ATCGGCTACATTCCACGGGGCAAAGTTCTAGGCCTCTCCAAGTTCGCTCG
TATAGCGG

Sequences in the Contig:

SY0AAA57YI15FM1