Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YI10FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00003305001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06991
Accession: ref|XP_001554403.1| Score: 150 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: ani:AN8085.2 Score: 125 E_value: 7e-06
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 112 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAA57YI10FM1
TTGGGATTGATTTGCGGACGTGGATCTAATAGATGTCTAACATGGCTTAG
GTTGTACTGGAGAAAAAATGTTCAGTATTATCCATTCCCCAACGATTTTA
CACACTTGATGATAGCATCGTGGCTTGGGCAACGGGCAGTCGTTGAGCGG
CTATTGGAGGGGGGAGAAGATATCAATGTGCAATCCGAGAAATATGGCAG
CGCATTAAATGTAGCAGCACTGCGGAAAGACAAGGATATAAGCAGAATGC
TTCTTAGGGGGGGCGCCAATGTCTATATAAGGGGCAAGGAGTATAACGTT
GTATGTGTATATAGGCCTCTTAGTATGGAGTGGCTAGTGCATAACTGACC
GTATATTCACCTTGTTTTACAGATGAAGAGCGTGAGTAAACGGCATTGAA
AATTTTAAATAACCACGACTAACATGGGATTTGTCTATGGGCGTAGAGTG
AGCTTGGAGAAAGGGCTGGGGTATGTGGATAGGATTAACCAAGATTTGGA
GGCGAGATAATTACTGACCTGTGGCTCCTTGGCTATTATAGAACGATTTG
GCAAGTTAACCGAATCAACCA

Sequences in the Contig:

SY0AAA57YI10FM1