Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YI02FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00009839001 E-value : 1e-147
Numbers of ESTs : 1

Blast Results:

Nr Definition: valyl-tRNA synthetase, mitochondrial precursor
Accession: ref|XP_001210188.1| Score: 733 E_value: 4e-76
KEGG Definition: hypothetical protein [EC:6.1.1.9]; K01873 valyl-tRNA synthetase
Accession: ani:AN1484.2 Score: 706 E_value: 3e-73
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0432 Score: 791 E_value: 3e-85
PFAM Definition: tRNA-synt_1, tRNA synthetases class I (I, L, M and V). Other tRNA synthetase sub-families are too dissimilar to be included..
Pfam Number: pfam00133 Score: 588 E_value: 8e-62
Swissprot: P07806|SYV_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0042802 = Molecular function: identical protein binding
GO:0006438 = Biological process: valyl-tRNA aminoacylation

Sequence:
>SY0AAA57YI02FM1
TTGGCCAAGATGAAGCCACAGTGGTGGGTACGACAGAAGGCCCTTGCTGA
TACCGCTATGGAAGCTGTGCGCAATGGGGAGATCAAAATTAGACCTGCTA
CATCCGAGAAGGAATTCTTCATCTGGCTTGAGAGAATTCAGGATTGGTGT
ATTTCTAGGCAGCTTTGGTGGGGGCATCAGGCCCCAGCTTGGTCTATTCA
CTTTGAGGGTGAAAATATCGCTGATTTTGATTATACCAACAATGACAACT
GGGTGGTGGCTCGTACTGAGGAGGAAGCCCAGGAGAAGGCTGCGAAGCTG
TACCCCAGCAAGAGGTTCACTTTGGACAGAGATCCTGATGTCTTGGATAC
CTGGTTTTCTTCTGGTCTTTGGCCGTTTTCTATCTTGGGCTGGCCCGAGA
AGACACCCGACATGTCAAAATTTTACCCCAACTCCCTCCTGGAGACTGGA
TGGGATATCCTGTTCTTCTGGGTTGCCCGTATGGCTATGCTTGGTATAAA
AATGACAGGAAAAGTCCCTTTCAACGAGGTTTTCTGCCACTCGCTTGTTA
GAGATTCAGATGGCCGTAAAATG

Sequences in the Contig:

SY0AAA57YI02FM1