Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YI01FM1
Length(NT) : 485
Best Gene Model Blast : Link to GSTUMT00005497001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05018
Accession: ref|XP_001593591.1| Score: 230 E_value: 5e-18
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07298 Score: 229 E_value: 4e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O43012|DCTD_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA57YI01FM1
TTGGCATTTCACCACGGTGATACCACCTTAGAAAATTACTACAATGCTGA
TTGGAATCTGCGGCAGTCTCTGCGCTGGGAAAACCGAAGTAGCGAAATAC
CTAGAGGCAAAACATGGCTTCACCCTGATTCGGATGGAGGAGACCAGCGA
CAGCGATAGCAGCGGCAGCTGCGCATCATGGACCGATGGGGAGAAAAGCT
ACCCCTCGTCCAAGAGCCTACTATCTTATATAACACAAAACTGGTCTAAA
CGGTTCGTTATGTTGGGAATGGGTTCGGTAGAGCTCAAGGTTCTAGAGAC
ATTCTTACGCCGGCCATTCTTCTTACTATTGAGCGTGGACGCACCGACAT
TAGTTCGTTGGCAGCGATATCAAAAGAGGGTTGATAGTTCATCCCCGGAA
CGGTCACTCGAGTACTTCGTTCAGGAGTGCGACACAAACATGTACCATCC
GGACCACGGTATATCACACCTCGTCCAAAAGTCTA

Sequences in the Contig:

SY0AAA57YI01FM1