Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YE04FM1
Length(NT) : 623
Best Gene Model Blast : Link to GSTUMT00005367001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09796
Accession: ref|XP_001240175.1| Score: 654 E_value: 6e-89
KEGG Definition: bifunctional pyrimidine biosynthesis protein (PyrABCN), putative [EC:2.1.3.2 6.3.5.5]; K00609 aspartate carbamoyltransferase catalytic chain; K01955 carbamoyl-phosphate synthase large chain; K01956 carbamoyl-phosphate synthase small chain
Accession: afm:AFUA_6G11310 Score: 649 E_value: 2e-88
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0370 Score: 670 E_value: 3e-71
PFAM Definition: CPSase_L_D2, Carbamoyl-phosphate synthase L chain, ATP binding domain. Carbamoyl-phosphate synthase catalyses the ATP-dependent synthesis of carbamyl-phosphate from glutamine or ammonia and bicarbonate. This important enzyme initiates both the urea cycle and the biosynthesis of arginine and/or pyrimidines. The carbamoyl-phosphate synthase (CPS) enzyme in prokaryotes is a heterodimer of a small and large chain. The small chain promotes the hydrolysis of glutamine to ammonia, which is used by the large chain to synthesise carbamoyl phosphate. See pfam00988. The small chain has a GATase domain in the carboxyl terminus. See pfam00117. The ATP binding domain (this one) has an ATP-grasp fold..
Pfam Number: pfam02786 Score: 142 E_value: 6e-10
Swissprot: O93937|PYR1_EMENI
Gene Ontology:
GO:0004070 = Molecular function: aspartate carbamoyltransferase activity
GO:0004088 = Molecular function: carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity
GO:0006207 = Biological process: 'de novo' pyrimidine base biosynthetic process
GO:0006520 = Biological process: amino acid metabolic process

Sequence:
>SY0AAA57YE04FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCCGGAGATGATCGATAGTGCGGAAAACCGGTACAAATTCTCC
CGCCTACTTGATAGAATAGAGGTTGATCAGCCGGCGTGGAAGGAGTTGAC
GAGCATTGAAGAAGCTGAAGCGTTTTGCGACAAAGTCACTTATCCTGTCT
TGGTCCGCCCCTCATATGTCCTTTCGGGTGCCGCCATGAACACTGTCTAC
TCTAAGGATGACCTTGCCTCGTACCTCAGACAGGCGGCCGACGTTTCCCG
AGAGCATCCTGTTGTCATCACTAAATATATTGAGAACGCAAAGGAGATCG
AGATGGATGCAGTAGCTAAGGATGGCAAAATGTTGATGCACTTTATTTCC
GAGCACGTCGAGAATGCTGGTGTCCACTCTGGTGATGCTACTCTCATCCT
CCCCCCTCAAGATTTGGATCCAGAGACTGGTACGCAGAATCGAAGAGGCT
ACCGGGAAGATCGGAAATGCCCTCAATGTCACTGGTCCGTTCAACATTCA
ATTCATCGCTAAGGATAACGAGATTAAGGTGATTGAGTGCAATGTCCGTG
CTTCTCGGTCGTTCCCCTTCGTA

Sequences in the Contig:

SY0AAA57YE04FM1