Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YC05FM1
Length(NT) : 562
Best Gene Model Blast : Link to GSTUMT00005820001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_13401
Accession: ref|XP_001803613.1| Score: 410 E_value: 1e-38
KEGG Definition: hypothetical protein
Accession: fgr:FG03842.1 Score: 385 E_value: 4e-36
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0471 Score: 236 E_value: 5e-21
PFAM Definition: Alpha-amylase, Alpha amylase, catalytic domain. Alpha amylase is classified as family 13 of the glycosyl hydrolases. The structure is an 8 stranded alpha/beta barrel containing the active site, interrupted by a ~70 a.a. calcium-binding domain protruding between beta strand 3 and alpha helix 3, and a carboxyl-terminal Greek key beta-barrel domain..
Pfam Number: pfam00128 Score: 268 E_value: 1e-24
Swissprot: P30292|AMY_ASPSH

Sequence:
>SY0AAA57YC05FM1
TGTACAAAAAGTTGGAGCAATTTGGTCAAGGGTTTCTTATGAATGTATGA
TATCGATAATGATATATAAAAAGACGCGATGATTCCCTCAACAATTCTTC
CCATCCTCATTCTTCACGGTTCTGCCCAGCTCGACCATTATCCGCGATTC
CCTTACTCGAGTACTTTCTCCTTCCAAGCGCAAGTTCTGGACGATGGTTA
AATTCTCTTCCTTGATCAGCCTTGTCGGGCTTGTTGCTTTGGCGCTAGCC
GCTAGCAGCGACGATTGGAAGACAAGGTCTATCTATTTTGTTCTCACAGA
CAGATTCGCGAGGACAAATGGCAGCACTAATGCCTGTTCAAACTTGGGCA
ATTACTGCGGCGGGACCTGGAAGGGGATGCAAAACCAGCTGGACTACATC
CACGGACTCGGGTTCAATGCCATCTGGATCACCCCAATCGTCAGCAACAC
CCCCGGCGGCTACCATGGTTATTGGGCAAAAGACATCTACTCCGTCAACA
CCAACTACGGTTCCGCAGCCGACCTCAAATCCCTCATCAATGCAGCCCAT
GCAAAGGGAATG

Sequences in the Contig:

SY0AAA57YC05FM1