Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA57YB03FM1
Length(NT) : 346
Best Gene Model Blast : Link to GSTUMT00009760001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05800
Accession: ref|XP_001592878.1| Score: 263 E_value: 8e-22
KEGG Definition: hypothetical protein
Accession: mgr:MGG_13481 Score: 243 E_value: 7e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA57YB03FM1
TGAAGAAGCAGCCAATCCCCCAAATTCTTTATAAATGCCTCTTCCCTTCC
CCAGGGCCCAAGGACCCTACCTCATTCGATCAATTTGTCAACGAAGTCCT
CGATCCCGAGATCCGCGCTGAGATCGCAGAATGGTATAACTGTCATACCT
CCGAAGAACTCGAGGAAGTCTATCCTGGCTGGGATTACGCCGACAACAAT
GTTCGTATGAGGCTCAGCAGATACAAGGGCCATAACAGACTCTTTAGGGC
ATTTGACAAGTTGGGCCTGAGTGCACACGAGATCAATAGCGTCGTCACCT
GGCATGGGACTAGGTGGGAGCTGGAGGACTGGGAGGCTGAAACCGG

Sequences in the Contig:

SY0AAA57YB03FM1