Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA56YJ22FM1
Length(NT) : 583
Best Gene Model Blast : Link to GSTUMT00006197001 E-value : 1e-114
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541436.1| Score: 168 E_value: 6e-12
KEGG Definition: hypothetical protein
Accession: yli:YALI0E28809g Score: 144 E_value: 2e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA56YJ22FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGGCGCAAAAAAAACCATCA
CGAACAAGATGAAGTTTGCCCATTCGTTCTCCCAAGTTCTACAGGAGGAG
GACTTCCCCGCTGATTGGCAAGCGGCCGCGATAAGGTATCGTCAGCTGAA
AAAGTGTATTAAGAAAGTACAATTAGAATTGTTGGATTTGGGACTCACTG
TGGAGGTGTTAAAGGGGTTGGCGGAGGAAAGGGAAAGTCCAAGTTTTGAA
TATATGTTTGATGGTTTGCCCTCTCTTTATCTACTCTTGTAGTTTTTGGG
GAGGGTACGCTGATGAGGGGTTAAATAGGTACGGTACATAGTTTTCAACC
AAAGTTAGTGTTGACGATTGATGCTGTCGACCTGATTCCACTCGATTTGA
ACCTTTCGGAGGACACCCGGCGGTCATTAGAGTGCCTAGTCAAGAAAAAG
CTAGGGAGGGAAGAAGTGGAGACTAAGGACGCTGCTGTAGAAGGTAGTAC
GGAGATGTGCAAAAGGTGTGTTAGTATAGTCTATTTGAGTGGAATAAGGT
CTCACATTGGGATGAAAGCATTCGGACCATTGA

Sequences in the Contig:

SY0AAA56YJ22FM1