Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA56YJ11FM1
Length(NT) : 538
Best Gene Model Blast : Link to GSTUMT00006197001 E-value : 1e-84
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG09856.1
Accession: ref|XP_390032.1| Score: 443 E_value: 1e-42
KEGG Definition: hypothetical protein
Accession: fgr:FG09856.1 Score: 443 E_value: 7e-43
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4159 Score: 119 E_value: 2e-07
PFAM Definition: SPX, SPX domain. We have named this region the SPX domain after (SYG1, Pho81 and XPR1). This 180 residue length domain is found at the amino terminus of a variety of proteins. In the yeast protein SYG1, the N-terminus directly binds to the G- protein beta subunit and inhibits transduction of the mating pheromone signal. This finding suggests that all the members of this family are involved in G-protein associated signal transduction. The N-termini of several proteins involved in the regulation of phosphate transport, including the putative phosphate level sensors PHO81 from Saccharomyces cerevisiae and NUC-2 from Neurospora crassa, are also members of this family. NUC-2 contains several ankyrin repeats pfam00023. Several members of this family are annotated as XPR1 proteins: the xenotropic and polytropic retrovirus receptor confers susceptibility to infection with murine leukaemia viruses (MLV). The similarity between SYG1, phosphate regulators and XPR1 sequences has been previously noted, as has the additional similarity to several predicted proteins, of unknown function, from Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, Schizosaccharomyces pombe, and Saccharomyces cerevisiae. In addition, given the similarities between XPR1 and SYG1 and phosphate regulatory proteins, it has been proposed that XPR1 might be involved in G-protein associated signal transduction and may itself function as a phosphate sensor..
Pfam Number: pfam03105 Score: 104 E_value: 9e-06
Swissprot: O14212|YDT7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAA56YJ11FM1
TTGGGACTGAATCGCATCAGGAGAGAACGATAGAAGAGGCAACTGAACGG
TTGACCTTTTTTGCGGGCGAGATTCGGCGGTTGGGGATCCAGGCCAAGTT
TAAGAATCCTTACAGCCCTTCTTTATTTAAAATGTTTCTGAGCGTGAACA
TGGATGTTCTTCGCATTATGCGGTTCCGTGACCTCAACAAGACTGCCATG
ACCAAGATTTTGAAAAAATTCGATAAACGCACAGCCCTTGGTGTCCGCCA
AAAATTCCCAACATTCGTAACGCCAACTGGACCATTAGCCTCACACCTCT
CTAAAGCTATTTGTCATACGCTCTGCACATCTCTCCTAAATGTGATCCCA
CAACTAGACGACTACCTTTGCCCAATATGCTCCAGCATATCAATCAAACC
TGTACGTCTCTCCTGCAACCACATATTCTGTGTGCGCTGTCTTGTCAAAC
TTCAGAGGGCGAAAAAGGACCCCTGCCCAATGTGCAGAAGGCAATGTGTG
CTTAGTGCCGATTCTGGAAATTTGGATATGGGGTTGTA

Sequences in the Contig:

SY0AAA56YJ11FM1