Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA56YI12FM1
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00004947001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_10579
Accession: ref|XP_001588133.1| Score: 317 E_value: 7e-28
KEGG Definition: ubiquinone biosynthesis protein, putative; K08869 aarF domain-containing kinase
Accession: afm:AFUA_4G06760 Score: 290 E_value: 5e-25
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1235 Score: 182 E_value: 1e-14
PFAM Definition: No Hit Found
Swissprot: Q06567|YL253_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAA56YI12FM1
TTGGCGGACGAGCAATTCCCGTTATTCGCTTCTGCGATCACTGGGCGAGA
CTATACGGCGCTACAAAAAGGCATAGCAAGTCCACGAGACGAGAATGAAA
AAGAAATTATCACTGAAGCTCTTGGCGAGGGACTCCTAGCACAGCTTGTC
CAGCTTCTCGCCAATGTCCCCAGCGTTATCCTCCTCATCCTGAAGACCAA
CGACCTAACCCGCAGTCTTGACGAGAACCTACAAGCAGGCACCGGTCCGG
AACGTCAATTCTTAATCCTAGCGAGATATTGTGCAAGAGTAGTATACGAG
GAAGCTGTGGAACTGGGCGGCTGGAACATCGTAATTGCAACTGTGGAGTA
CTGGCGCATCAGCTTGAAGCTACGAATCTTCGAGTGGGGTGTTTGGTGGA
GGGGTGTATTTCTTGCCACTGCCTTTGGTGGGGTAAGGCTGTTAGAGGGG
TGAATACTGTTATTACTAACCGAGGCCTGGTGGGCTATGGAATGTGGTAG
TTTCCGCGATCGCATATTTAGATTAGGGGTTGGAGACGCATATCATATCT
TAGAGTGAAGGGGTGTTGGGAGGGGGGATGGAGATTG

Sequences in the Contig:

SY0AAA56YI12FM1