Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA56YH21FM1
Length(NT) : 552
Best Gene Model Blast : Link to GSTUMT00010860001 E-value : 1e-122
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 136 E_value: 6e-07
KEGG Definition: hypothetical protein
Accession: ani:AN8767.2 Score: 132 E_value: 9e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA56YH21FM1
TTGGGCCCAACGTGCCGGATTATTTCGGCCTAATACCACTCTCCTTTGCC
GCTTTAAATGGACATCAGGGAGTAGTAAGAATACTCCTCGCGCAGGAACA
GGTCAACTCTGAAAAGCCGGACAATGGTGACCAAACACCGCTATCGATCG
CTGTCAGGAACGAATACAAAAGGATAGTAGCGCTGCTACGGTCTCGTAAA
GCGGAAACCGCTAGCCCAAGTTGAGGCGCAGGAAACAGCACCTCCTCCAA
TCCACCACTTTTCCTTCCCCTTCGTACTCTGTTACTCGCGGAGGTTGTCC
GGTAGGATCACTCTTTGTATCAGAGGGAATCCAAAGGGATCGGAGTACAC
ATAAATGCCACCACACCCTCCTAAACCTCCCTCCGTATTTGCTTAAGGGT
CGAGTCAGGATCTAGGAGTTTTTATTTACAATGTATAGTATAGTTCCCTC
CGCAAGGTGAAATAGCTTTGTTGACGCTTCGTTGTTGTGGGCGGTCCAGA
TTAAAGATTGCGGTTTTTATCTTATCATTTTTAATTTTCCTCTGGTTGTA
AA

Sequences in the Contig:

SY0AAA56YH21FM1