Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA56YE10FM1
Length(NT) : 603
Best Gene Model Blast : Link to GSTUMT00007694001 E-value : 9e-98
Numbers of ESTs : 1

Blast Results:

Nr Definition: mitochondrial carrier protein
Accession: ref|XP_001259461.1| Score: 225 E_value: 4e-17
KEGG Definition: mitochondrial oxaloacetate carrier protein
Accession: aor:AO090120000354 Score: 225 E_value: 2e-17
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0755 Score: 200 E_value: 8e-17
PFAM Definition: No Hit Found
Swissprot: Q9UTN1|OAC1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAA56YE10FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGTAACAGGACATGACATT
TCACAAAACCTCCCTGCCCTACTACCAGTACCGGTAAGCCCTATTCTACC
TACTGTACACCACCTTTACCACACCTCCTTTACCCTTTGCCCTCCTCGTC
CCACCACTGCCGCCACTAGAAACTTGACCCAGAAAGCGCAATGTCTACGA
CATTAGGCGGCTTCATCGCCGGTAATCGCAGCCTGCGGAGCAGTAACAGT
CACTCACGGCTTCGAAACGGTGAAAACAAGGTGCGTATCATAACCGCACG
CTACACATGTACCTACACACATACACCGGCTTCGGACATGAGAATGTCCC
CCGGGAGAGTGAGGGGGTTGCGGGAGCAAAACAAAAAGTGAGCTGCGCTT
ACAAAAATTGCTATGCGGGTGGGCAGACTTCAACTCCAAGGCGAGCTTTC
AGCAAAGTCGCAAACGAAACGAGTCTACACAGGTGTATTCCAGGGTGTTC
GAGTGATCTTGGTAAACGAAGGGCCGCGTGGCTTAATGGCTGGTTTGGGC
GCTGCTTACTGCTACCAAACCATGCTAAATGGCTGCCGTCTCGGCTTCTA
CGA

Sequences in the Contig:

SY0AAA56YE10FM1