Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA56YE09FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00003823001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: F-box domain protein
Accession: ref|XP_001266321.1| Score: 175 E_value: 2e-11
KEGG Definition: F-box domain protein
Accession: afm:AFUA_5G02120 Score: 174 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA56YE09FM1
TTGGCCTCCGCATCACTAACCCACCTCGCCTACGAAATCACCGATGATGA
GACATCCACCAAATCGCTCGCGAAGCCCTCACCCTCGTACTACGCGTACC
TCTCTGAATCCCTCTGGAACGGCGGAATGCCAAAGCTGAAAGACCTCTAC
GTCCGCGAGCCAGCGTTCCATGCACGCCTTCAGAAATATAAAGCCTCTGC
GGGGGTGTTTGCTGCGACGGGCTGGACTCAGGATGTGCACTTGTATACCA
AGGGAATGGAACACTTGGAGTGGACAAAGTACAGCATTGGAGACGTCGGC
GGGAATTTACTGATCCTGTCGACCCTTAAAAGGGAGGCCGGCTCACATGC
CAGCTTTTTCGCGGGCCTTAGCGACAGAAACGAAGTCGGGGATGGCAGGG
CAAGCTTCCTCGCCATACCCAGTGAGGCGGGGGAGTGCACGTCCGGCAAG
CGGGAGAGGAGGAAGAGTCGGGTGAATTTGTGGAGGTGATTGGTGGGCAT
TTTCAACGGGATGGGTGTATATAGCTGCTTTTTTTTTTTTTTTCTTGGAG
GGGCGTATTTTCTTTAAACTTTTCGCACTGTATGGT

Sequences in the Contig:

SY0AAA56YE09FM1