Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YP08FM1
Length(NT) : 201
Best Gene Model Blast : Link to GSTUMT00004673001 E-value : 1e-111
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN5102.2
Accession: ref|XP_662706.1| Score: 194 E_value: 8e-14
KEGG Definition: hypothetical protein
Accession: ani:AN5102.2 Score: 194 E_value: 4e-14
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1189 Score: 112 E_value: 5e-07
PFAM Definition: No Hit Found
Swissprot: Q5B2X8|SPT16_EMENI

Sequence:
>SY0AAA55YP08FM1
TCGTCTGGGCGGCTTGGTCGCGGCTTGGAAGGATTCGAAGAAGGCGGATT
TGTTCGGTGGTGTTGGCTCTATTGTCATAATATTGGGGAAGACTGTGGAG
GGCCCCTATTCGAAGAGTCTTGCTCTGCATTTCTGGTTGCTAGGGTACGA
GTTTCCAACAACGCTCTTTGTCGTTACCCAAGAGAAATTTTATGTTGTGA
C

Sequences in the Contig:

SY0AAA55YP08FM1