Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YO14FM1
Length(NT) : 498
Best Gene Model Blast : Link to GSTUMT00009460001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN6090.2
Accession: ref|XP_663694.1| Score: 378 E_value: 4e-35
KEGG Definition: hypothetical protein
Accession: ani:AN6090.2 Score: 378 E_value: 2e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2343 Score: 235 E_value: 5e-21
PFAM Definition: Mak10, Mak10 subunit, NatC N(alpha)-terminal acetyltransferase. NatC N(alpha)-terminal acetyltransferases contains Mak10p, Mak31p and Mak3p subunits. All three subunits are associated with each other to form the active complex..
Pfam Number: pfam04112 Score: 252 E_value: 6e-23
Swissprot: Q9USY3|MAK10_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA55YO14FM1
TTGGGCCGAATCCTACCCCAGCTCCAACAACCAACCCAATAACCCCAGTT
CCCCAGGCCACTATGGACTCCTTTCGAGATGTTACGGCAGAATTCTTTGA
GGCTTCAGAGATGCTGGAGATCGGCCAACTGGTCAAAGACCCATACTTTA
CTCTACTTCAAGCAGTCGGCGCTTTGGAGATTATGGATCCTAAGATGGAT
AGTGGGATGCTACGGGCAGAATATGAATCATTCGATGCATTACAGCCAAG
ACTACCGGAGGAGGTTGTGGGGATTATGGATCAACTCCTATGCCATGAGA
TGGCGTGGAACAGAGGAAGTGCTCTTTCACAGACATTATTTACTTCACTT
TACATAGATAGGCTCCTGTCTTCTGGCCCTTCTTCCCTTGCTGAAGCGAC
ATTCCGAGGACCTCATGGAAAGAAAACCGATACTCCTGAGGCTCAATTGG
TAGAAAATGTGCTGCAACCCTTCTGCGTTGGGTTGATCAAATGCTGCA

Sequences in the Contig:

SY0AAA55YO14FM1