Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YM23FM1
Length(NT) : 605
Best Gene Model Blast : Link to GSTUMT00000876001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15203
Accession: ref|XP_001805361.1| Score: 216 E_value: 4e-16
KEGG Definition: hypothetical protein
Accession: yli:YALI0B07601g Score: 201 E_value: 1e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA55YM23FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCTTCCATTCACTAAGCGGAGTACTTACTTGCGGAGGCTTAAC
GGAGCATCAACACACCACACAACGATAAGCATGCGCTTCTCAGCGATCGT
CCCGATAGCTCTGTCTATCGCGGCCTTCATACTTTCTATGCTAGTGCTGT
TTGCCGGTAGGAATAATGGGTTCCTGGGCGACACTTATGTCACTAAGATC
GATACTTCAAACCTCAACGTTTCAAACACTGGCATCAGCGCACTCGACAA
TATCCTCGACTCAGCCGCCCAGGACATCGTTAATACCACTGCCTCTCGCC
TCGGTTTGCACGATTTCTACAAGGTCTTTATTATGAACTACTGCGAAGGC
GAGCGCGATTCCAACGACAATGAGCGGATTACAAACTGCACTAAGCAGAA
GGGGATGTTCACCTTCAATCCTGTCGGTGTTTTCGAGAGGGAGTTGTTGC
AAGGCGTGACGTTGCGGGACCTGGGTGTCAATACTCAGGACCTCGACACC
GCTATCAATGTCTTGAAAGTTGCGTACAGGACTATGTTTGTCACGTACTG
CATTG

Sequences in the Contig:

SY0AAA55YM23FM1