Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YJ05FM1
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00008745001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04766
Accession: ref|XP_001245325.1| Score: 551 E_value: 6e-55
KEGG Definition: hypothetical protein
Accession: ani:AN0293.2 Score: 548 E_value: 7e-55
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2564 Score: 463 E_value: 3e-47
PFAM Definition: No Hit Found
Swissprot: Q5BGN7|PPME1_EMENI

Sequence:
>SY0AAA55YJ05FM1
TTGGGAGTATGCAAACGTACCTTTCTACGAGACCTTCAGGATTTACCTCA
CTATCACAAGGAATCGAATGGCACACCCGTTCGAGAACAATCCGAAACCC
AACCTCAGCCCGCATCTCTGTTCCTGCTCTCCTTCTCCTCACCGACACAA
CGCAGCCTGAGTCATCAGACGATTCCTCCCCCCCACGTCCCTGGCGCTGG
CGTACCGACCTAGCAAAGACGCAGCCATTCTGGCAAGGCTGGTTTGTGGG
ACTCAGCAAGAAGTTCCTGGAAGCCCGGGGGGGCAAGTTACTCATTCTTG
CGGGGACGGATAGATTGGACCGGGAATTGATCATCGGCCAGATGCAGGGG
AAGTACCAACTTGTCGTACTACCAGAGGTGGGCCACTTTTTGCACGAAGA
TGCGCCGGGGAAGACGGCAGGGAGTTTGGTAGAGTTTTACAAACGGAATG
ACCGATCAGCCTTGGTGCTGCCGCCGAAGGTTTCGGACATGTATAAGTAA
CCGTCGGACCATTACCCTCTACCGCAGCCATATATCCATACTATGAGGCG
GTACCGCCAATGCGCTCTCTCAGTCACAAAAAAGCCAACATTGAAGAAAA
AGGCTACACCCCTATCAC

Sequences in the Contig:

SY0AAA55YJ05FM1