Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YI20FM1
Length(NT) : 458
Best Gene Model Blast : Link to GSTUMT00003180001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_00016
Accession: ref|XP_001790714.1| Score: 318 E_value: 3e-28
KEGG Definition: hypothetical protein
Accession: ang:An15g02900 Score: 276 E_value: 1e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9Y7U5|RGF3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0005089 = Molecular function: Rho guanyl-nucleotide exchange factor activity
GO:0006075 = Biological process: 1,3-beta-glucan biosynthetic process
GO:0048228 = Biological process: actin cortical patch distribution
GO:0030994 = Biological process: primary cell septum disassembly
GO:0035023 = Biological process: regulation of Rho protein signal transduction

Sequence:
>SY0AAA55YI20FM1
TTGGGGGACGTGGACCTCAGGCTTGACGAGAAGGGCAGAGAATTAATCTT
CAAAGGGGATTTGCAGAGAAATGGGAATAACAGATTTACCTGGTTGGAGA
CTCATGCAATCTTGTTTGATCATTATCTGGTCTTGGCAAAGACTACAATG
CAAAAGGACGCGCATGGTGGAGCCAAACATGGGAGGTACGACGTTTCTAG
AATGCCAATTCCTATGGATTTGCTTGTCCTGGAAAGCACCAATGACGAGC
CGGTTGTCAGGAGCACAGCAAACAGACTTGGTATCGGAGGCCCTACAGCA
GCAGCAAAGGATAAGAATGAGCAAAAGTCCGGCAGACACAATACCATAGC
CGCAACTCCTAGTCCTGGAGCACTCACACATTCTAATACTGGTTTATCTA
CTACTTCTACCAATACTGCTCCCGGTAGGCTGGTCACTGCGTTACCAGAT
CGCAGTGC

Sequences in the Contig:

SY0AAA55YI20FM1