Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YI18FM1
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00002256001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_07194
Accession: ref|XP_367269.1| Score: 282 E_value: 1e-23
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07194 Score: 282 E_value: 6e-24
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3306 Score: 145 E_value: 2e-10
PFAM Definition: DUF2012, Protein of unknown function (DUF2012). This is a eukaryotic family of uncharacterised proteins..
Pfam Number: pfam09430 Score: 320 E_value: 1e-30
Swissprot: Q0IHY5|CO024_XENTR

Sequence:
>SY0AAA55YI18FM1
TTGGCCTAATACGGCGTGATAATACCTTCAGCTTTCGTGATGTCCCGAGG
GGTCATATCTGCTCGATGTGCAATGCCAGACTCATCAGTTTGCGCCTTTA
CGGGTAGACGTCAACGGGCAAGGGGAAGTGGTCGTGCACCAGACTTTCCG
CGGCAATGAATGGAGGAATAAGGGAGAAAGGAAGAGTTATCCCATAGAAA
TCCAACCAGTTCGTCCTATTGACTACTACGTCGTTCGTGAAAGCTTCAAT
CCTACCAAGCTCCTCGGATCACCAATGGTTCTCATCGCCCTCTTCACTCT
AGTCATGATCGTCATGTTGCCCAAACTCATGGACCAAATGGACCCAGAAT
TCAAGGCGGAGCTAGAAGCACAGCAGCGCAAAGGCGGCGTAAACCCTGCA
GTAAACTTCGACGTCGCATCCTTCCTTGCCGGAACCTCCTCGCCAGCTAC
CGGCGTCGCTGCATCTGGCGGGAAAGGAAAGAAAAATTAGATGAGCCTGC
CTCATTGTCTTTTCTCACATCTTTTTTTTCTCCCTCCTTTAATTGTACAC
GGTTAAATGTTTAGACATCTGGGATCTGGATTGGCGGACTAGACTGGAGG
ATTCTGCCTGGACGAGCAAAACAAATGAGCGGATTAGGTGGGGGTGGGGG
TGGAGTCGAA

Sequences in the Contig:

SY0AAA55YI18FM1