Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YI10FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00001134001 E-value : 1e-180
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquitin-conjugating enzyme E2-18 kDa
Accession: ref|XP_001543565.1| Score: 418 E_value: 8e-56
KEGG Definition: hypothetical protein [EC:6.3.2.19]; K04555 ubiquitin-conjugating enzyme E2 G2
Accession: dha:DEHA0A02937g Score: 408 E_value: 3e-55
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0426 Score: 502 E_value: 1e-51
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 324 E_value: 4e-31
Swissprot: O00102|UBC7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0030466 = Biological process: chromatin silencing at silent mating-type cassette

Sequence:
>SY0AAA55YI10FM1
TTGGCACCCACTCTACTACGACAACCCCACAAAGCAGATGAAAAATGGAA
AACATTAAAAAAGCCCCAATGCCCTCCTCGCACAAGCCCTAACCCTCTTC
TCATACTCCTTTCGGTCATCCCTCCAAATCTTGGAAGCGTCAATATTCGC
GCCGCTCTCGTCGTTCGGCTCTGCAAGCATGCTCATGACGCTGATGAGTA
TCTTCTCAACACTCTGTATTGGCGACCAACGCTCGCTGGCATCCTCATAC
TGGTTCGGGTCGTCACCGGGAGAGTGTAGTATTGAGATGCACACGGTGCC
GTCCTTGTACACATTCGGATGGAACATTTCGCAGGTGAATTTCATCTTGG
GAGGATTAAGGGGGTAGTCCTGTATATATCTTAGTTAGCTGGCTGGAGTA
GAGATTTTCTTTTTCCTTTTCTTGTTTTGTTTGTACACGAGTAATTGGGT
AGAGATTGGTTCTGATCTTTTTTTTCTCTTTCCGCCCGCCCCTGCCTGGT
AGATACATTACATACCTTTGGAAAACTGAGCGTAGCGGGAAAAACCCCGC
CTTCGAATGGAGTCTCCTCCGGACCTTGGATTAAGCATTCCCATTCGAAG
AGGTTGGATTCGTCGATGGGCCCGGCGGCGATGCCTTCCGGGGATTCCTT
CAGCAGGGCTTTGTATTC

Sequences in the Contig:

SY0AAA55YI10FM1