Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YH20FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00011420001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_501757.1| Score: 260 E_value: 3e-21
KEGG Definition: hypothetical protein
Accession: yli:YALI0C12364g Score: 260 E_value: 2e-21
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 125 E_value: 5e-08
PFAM Definition: No Hit Found
Swissprot: Q03125|NRG1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0003677 = Molecular function: DNA binding
GO:0016564 = Molecular function: transcription repressor activity
GO:0042710 = Biological process: biofilm formation
GO:0006006 = Biological process: glucose metabolic process
GO:0001403 = Biological process: invasive growth in response to glucose limitation
GO:0007124 = Biological process: pseudohyphal growth
GO:0006357 = Biological process: regulation of transcription from RNA polymerase II promoter
GO:0009268 = Biological process: response to pH

Sequence:
>SY0AAA55YH20FM1
CACCCTCCGTGACCTCCTCACCAATACCCAGCCCCGCAATGATGATGATA
GCAGCAACATCGGAGGAGCTGTCGCCGACTAGCTCGCAAGCACCAATCAC
TTCCGCGCCGCCATCGCCAAAGACGTCGAGTGCCGCCAACCCGTCGCTCA
AGAGGAGCTCGCGCAGGTACACATGTCAATGCGGAAAGTCGTTTACCACG
TCCGGACACCTGGCGCGACACACGAGAATCCACACGGGGGAGAAGAACTA
CGTTTGTCCGGAGACGGGGTGCGGGGCCAGGTTCAGCAGGCAGGACAATT
GCATGCAGCACTACCGCACGCACCAGAGCGGGTCGGGGAGCAAGAGGGCT
GCCAGGAAGCGGAGGATGTCGGCTGAGTCTGCGGAGGCCGTTGGCAACAA
GCCGGATATGCACCCGCAAATGCACTCGTATCACACTCCGCAACCGGTTT
CCTACAGTCATTATCCAGAATCGTTTGATGGGGGGCTCACGGCTCTGGCG
AACGCTGCTATATCAGGGTATCCTTGAAGGGCTTTATCTTTTTTTTCTCC
TTTTCCTTTTTTTATCCTTCCTTCTCCCCTGATTAAAACAAAAGTAACTT
CCTCTCTTCGCTTTCTTGGGCCCCTC

Sequences in the Contig:

SY0AAA55YH20FM1