Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YF04FM1
Length(NT) : 612
Best Gene Model Blast : Link to GSTUMT00007439001 E-value : 2e-95
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11008
Accession: ref|XP_001587768.1| Score: 427 E_value: 5e-43
KEGG Definition: hypothetical protein
Accession: ang:An07g06840 Score: 431 E_value: 8e-43
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1335 Score: 388 E_value: 2e-38
PFAM Definition: No Hit Found
Swissprot: O00087|DLDH_SCHPO
Gene Ontology:
GO:0009353 = Cellular component: mitochondrial oxoglutarate dehydrogenase complex
GO:0006103 = Biological process: 2-oxoglutarate metabolic process

Sequence:
>SY0AAA55YF04FM1
TTGGACCAGAACCTCGAGCAATCAATCATCACTCCCAAAGGAAGTAAAAA
AGCTACCCTTCCTTCATTCCCTCGACTTCTTCCTCTTTCTACGTTTAACG
GATCATCGGGATACCCCCCATTGCAGTTTTTTTCTCTTGTTCAAGCAAGC
ATGTTGAAGCCTTTCATTCTTAGACATTCATCCCGCTCATTACTCCGGCC
TTTGAGTGCTAAGGCTGGTGGATATGCCCCCTCTACGTTCCTGCTTGTGC
AGAGGAGGGGTCTTGCGTCGGAAGCTGAGGAACACGACGTTGTAGTTATA
GACCGCTTGTGTTGAGAAGCGTGGCTCCCTTGGTGGGACTTGCTTGAATG
TTGGGTGTATTCCCTCAAAGTCTTTGCTCAACAACTCGCATATATACCAC
CAGATTTTGCACGATGTTAAGAATCGTGGGATTGATGTCGGTGATGTCAA
GCTCAACCTAACACAGATGATGAATGCGAAGGAACAATCCGTCTCGGGTT
TAACAAAGGGCATCGAATACTTATTCAAGAAGAACGGCGTCGACTACGTT
AAAGGAACTGGAACCATCACCAGCGAACATGAGATCAAGGTTGGTCCGTT
GGATGGTGGGGG

Sequences in the Contig:

SY0AAA55YF04FM1