Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YD17FM1
Length(NT) : 647
Best Gene Model Blast : Link to GSTUMT00003292001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: HLH transcription factor (GlcD gamma), putative
Accession: ref|XP_001269292.1| Score: 317 E_value: 9e-28
KEGG Definition: HLH transcription factor (GlcD gamma), putative
Accession: afm:AFUA_1G09670 Score: 304 E_value: 2e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA55YD17FM1
TTGGTGCAAAGCTTGAACAAGAGAAGGAGCTACGGGAACTCGTTACCAGA
CTAGGCGGAGCGTACCCATTCGAGCAGACTGAGGACGATAAGCGTATGTC
GTCTGAATTATACACCGCCATTGAAAAGAATGGTGTCCAAAGCTTTCACT
ACTCCCGAGCGCCCGGGTCCACATTGAGGGTGCCTGGATACACTGACTAC
GCAGGCAATGCGGTGGGTCCTGGAGGGAATGTTCTTTCCCCACGTGTCAG
TCCATCGCGCTCGGGTGGAAAACCTTCTCAGAATGGAGGATCCTCTCGGG
GAACACCCCAGCAACAGTCACAGTTTTGGGGCCAGAATGGCGATGGCATG
GCGTTCAAAGAGGAGGATGAATATAACTCTATGGACATGTCATAACCTTT
TGTGAAGACGATAGTACCTGTACAACTTCCCCTTTATGGGCGACACTGCC
GGTCATTCTAGAACATCCCGGCTGTACACGTTATAAAACTTCCTGGAGCA
TATAGTCTTGGGCGAGCGTACGGTTAGTATTATGTCTTTTTTTCCATTTT
CCATTTTTTTCTTTTCGCTATTGGATGTTCGTCATACCGCCTTCGCAACC
CGCGGGAGTATATGGAGTCGGATGGGCTTTTTGTAAGTTCTGTTGTA

Sequences in the Contig:

SY0AAA55YD17FM1