Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YD04FM1
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00005842001 E-value : 1e-149
Numbers of ESTs : 1

Blast Results:

Nr Definition: saccharopine dehydrogenase
Accession: ref|XP_001593244.1| Score: 319 E_value: 7e-43
KEGG Definition: hypothetical protein
Accession: ncr:NCU03118.1 Score: 312 E_value: 7e-42
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0172 Score: 238 E_value: 3e-21
PFAM Definition: AlaDh_PNT_N, Alanine dehydrogenase/PNT, N-terminal domain. This family now also contains the lysine 2-oxoglutarate reductases..
Pfam Number: pfam05222 Score: 156 E_value: 9e-12
Swissprot: Q7SFX6|LYS1_NEUCR
Gene Ontology:
GO:0004754 = Molecular function: saccharopine dehydrogenase (NAD+, L-lysine-forming) activity

Sequence:
>SY0AAA55YD04FM1
TTGGGTGTAAACCGCTTGAGCACCGCTCTGCCCTTACTCCCGCCACTACC
AGCGCTCTTTTAAACGCTGGTTATGATGTCCGTGTCGAGCGTAGTGAGCA
GAGAATCTTTGATGACAGTGAGTTTGAGAAGTAAGTCCAATACATTTCGG
GGCACTTTTCTTAGGGGATAACTTGTTAATTACTCAAAAGGGTCGGTGCT
ACGCTTGTTCCCGAGGGCTCCTGGACTGGTATGTTGAGCCACCCACCTTG
TGCTAAATTCCTGCGCTGAGCGAGTGACCATTGCAATTCTCAATCCAGAG
GCACCCGTGGACCACATAATTATTGGCCTTAAGGAACTCCCTGATGATGA
CTTCCCTCTCAAGCATACTCACGTCCAATTCGCCCATTGTTACAAGAACC
AAGGTGGCTGGGAAAACGTACTCTCTCGCTTCCCCAGGGGCAAGGGCACT
CTCCTAGACTTGGAATTCCTTCAAGACGATAACGGTCGTAGAGTTGCTGC
GTTCGGCTATCATGCTGGATTTGCCGGCGCTGCACTAGGTCTTGAGGTTT
GGGCATGGCAGTA

Sequences in the Contig:

SY0AAA55YD04FM1