Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YC14FM1
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00010950001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56888.1| Score: 150 E_value: 2e-08
KEGG Definition: predicted protein
Accession: aor:AO090001000363 Score: 150 E_value: 1e-08
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0307 Score: 132 E_value: 7e-09
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 130 E_value: 1e-08

Sequence:
>SY0AAA55YC14FM1
CATGGCATAAAACTCTTGGCAAGTTTGCGTCATATTGGGACAAGGCTTCG
AGGGCGCCAGTCGAGGTATCTTCTAGGGCACTGGCACCTCGTACACCTAC
CCTACCGTCGATTCCCAGCTCTTTGCCTTCTCCGCCGGCGACTTCGTCCA
ATGGGTCATCCAGGTTGGTTTCTACAATGCCGACACCAACCCCGGCATTG
CATCAACTATCGGTTCCTTCTCAACTCATGCCAGCACATTCTCCGATTAC
CCCTATGCCCCAACCCGACTTTCAGCCTTCCAGGAAAAGGTCCTTTGACC
CCACAATTAGCATGCAGCCACCAACGAAACGGGTTACTCGTTCAATGGCT
CCTAAAATATCTATTACTGTGCCACAGTATTCTGCACAGATACCCGCTCA
TGCTCCGAGGTTGCCTGCCAATAACTACCCTCCGGTCACTAGCCAGCCCC
AGCAGCAATCGCAGTCATTACCAATGATGCCACTGAATCAATTACCCTTT
CCCAACGCCGGGGGTCGTGCAATGTCTACAGTGTATTCTCAACCCACGCC
TCAGATATCACCTGTTAGCACAGCTCCCATGACTGTTTCTCCTTACAGCG
CACATTCTCGTACTGCTTCTCCTTACTCTCAACACCAGACTGTT

Sequences in the Contig:

SY0AAA55YC14FM1