Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA55YB14FM1
Length(NT) : 121
Best Gene Model Blast : Link to GSTUMT00011411001 E-value : 7e-64
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_14865
Accession: ref|XP_001546633.1| Score: 125 E_value: 8e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA55YB14FM1
ATTGCGGGTGATCCCGCCGTGTTGCGAACCCTTCTACGGTGCGACTCGGA
AGTCAATGCGACGAATAGCAGGGGATTTACAGCCCTGATGGTAGCGAGCA
AATATGGTAGAGTCGAGATGG

Sequences in the Contig:

SY0AAA55YB14FM1