Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YN11FM1
Length(NT) : 485
Best Gene Model Blast : Link to GSTUMT00006306001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01888
Accession: ref|XP_001248117.1| Score: 335 E_value: 4e-30
KEGG Definition: predicted protein; K04798 prefoldin beta subunit
Accession: aor:AO090005001299 Score: 306 E_value: 4e-27
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3478 Score: 325 E_value: 2e-31
PFAM Definition: Prefoldin_2, Prefoldin subunit. This family includes prefoldin subunits that are not detected by pfam02996..
Pfam Number: pfam01920 Score: 252 E_value: 5e-23
Swissprot: P52553|PFD6_YEAST
Gene Ontology:
GO:0016272 = Cellular component: prefoldin complex
GO:0015631 = Molecular function: tubulin binding
GO:0007021 = Biological process: tubulin folding

Sequence:
>SY0AAA54YN11FM1
TTGGTGAGAGAGTGTGAGCGAGAGGGGAAAACGTTCGTCTTCCGACCACT
ACACCATGGCAGGAAAAATGTTGCAAGATCTTACGGATCAGTTTCAGGCT
CTGTCCAAAGACATGAGCTCTATCGTCGAGGCGCGACAAAAATTAGATTC
GCAGCTTCAGGAGAATAGGTCTGTACAAAAGGAATTTGCGAACCTGGCCG
ATGATGCAAAGATCTACAAGCTCGTTGGGCCCGTGCTCGTTAAGCAGGAC
AAGTCGGAGGCGGTAATGAATGTGGATAAAAGATTGGAATTTATCAACTC
AGAAATCGCGCGCATCGAAAAGCAGATCACCGACATTCAAGAGAAGCAGG
AACGGAAAAAGATGGAAATCATTCAGGTTCAATCTCAACTACAACAAGAT
GCCCAAGCGCAAGTAGGAGCATAGTCTAAATTCTAAGAAGGAAAAAGAAA
CCATTCAAAAACCACCCTTTCCCAAATCATACTGC

Sequences in the Contig:

SY0AAA54YN11FM1