Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YN07FM1
Length(NT) : 329
Best Gene Model Blast : Link to GSTUMT00005598001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: C6 finger domain protein, putative
Accession: ref|XP_001260314.1| Score: 128 E_value: 3e-06
KEGG Definition: C6 finger domain protein, putative
Accession: afm:AFUA_2G08040 Score: 128 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 128 E_value: 6e-09

Sequence:
>SY0AAA54YN07FM1
TTGGCTACAACCCCTACACAGATGATGTCCCATCAACATATGTCTACTTC
GACATCTGGCGTTACAAGCCCCGTTGTTACAACACCAACTGTTGGTGGTA
TTCCGGGAACAATGATGGGAAATCCGCAAATGAATGTGGTGACTACCTAC
CCTCCGCGTCGAAAGGCAATTAGAGCTGCACAAGCGTGTGACGCCTGTAG
AGCTAGAAAGGCTAAATGCGACGAAGGAAGGCCGAGTTGTGGCTTCTGTA
AGGAGTCACAGATTGCTTGCGTCTATCGAGAAGTACCACCACCGAAGCAA
GATAGGACATTACTCCAGATTTTGGAGCG

Sequences in the Contig:

SY0AAA54YN07FM1