Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YL13FM1
Length(NT) : 390
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212674.1| Score: 196 E_value: 5e-14
KEGG Definition: hypothetical protein
Accession: ang:An15g06750 Score: 193 E_value: 5e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA54YL13FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTAAACATCGATGCAATCT
TGGCACAAGTGACGATCTACAAGAGAAGAGAAAAACTCCATCAGATGACA
AATGGACTCGGTTTAGAGGATGCATACACTGCGACTATTAACCGAATCCG
CGAGCAGAGTGGCAATAAACCAAAAATCGGGATGGACGTACTGATGTGGA
TCTCTTGTTCAGAGCGGCCATTGCGGGCCGAGGAATTATGTCACGCTCTA
GCGGTCGAGATGGGGTCTACGGATCACAACCCCCATAATGTTCCTTCAAT
ACGGACATTGCTGGGTTGTTCCCTCGGACTTGTCACAATTGACGGGCGAA
CGTTGACCTTCCGTCTAATACATTTCACATTACAAGAATA

Sequences in the Contig:

SY0AAA54YL13FM1