Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YK23FM1
Length(NT) : 417
Best Gene Model Blast : Link to GSTUMT00009761001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_00571
Accession: ref|XP_368673.2| Score: 341 E_value: 7e-31
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00571 Score: 341 E_value: 3e-31
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1361 Score: 112 E_value: 7e-07
PFAM Definition: No Hit Found
Swissprot: Q5XIX3|DCR1C_RAT

Sequence:
>SY0AAA54YK23FM1
TTGGCTTAATACCCGGCTCCAAGAGCCTCAGTTCTGTTGCTTTAATATTC
GATGAGTTCGGTGGGAAGTTCATAATGTCCACTTTCAAAGGAATAGTTAC
GGAGTTTCCGGATATAAGAATTGATTATTTTCGTCAGAGTAATGACTCGG
GGGCGCGCCCGGCTCTAGCCTGCTTTCTGACACATATCCATAGCGATCAT
CTGCAAGGCTTGGAAGGGTTCTACGGTGGCCCTTTCATCTATTGCTCGGC
GGCTACTAAGGAGCTGTTGATAAAACTGGAGAGACGATTACACCGTTTTA
ATCTCGCAAAAGGCGTACTTGAAGCACGGCGATGCCTTTACGCCGAGAAA
GAGAAGAAGCTTAAAGTCATCCCACTAGAAACCCCGACAATGGTTGAGAT
AGGAAGTGGAAAGAGTT

Sequences in the Contig:

SY0AAA54YK23FM1