Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YJ23FM1
Length(NT) : 403
Best Gene Model Blast : Link to GSTUMT00012719001 E-value : 2e-94
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An07g06910
Accession: ref|XP_001391766.1| Score: 135 E_value: 5e-07
KEGG Definition: hypothetical protein
Accession: ang:An07g06910 Score: 135 E_value: 3e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA54YJ23FM1
TTGGGGCATTCCTCGAGAAGATTGATGGCTATGCGGTGCAGAATGCTGCG
CGCAAAGAAAGTTATTCTGGGGAGAGTACTACCCTGCCTTAGGCTAAAGG
CGCAGGCTGCGATACATGAGAGGGCAAGCCCGAGTTTTCTGATTGAACTA
GCGTTCAAGATAGCTGCTATCCTCGGCCATTCCAAGAATTCCTTTCTGCC
AGTCGGGAGTACAAGGTTCCCAGTCCCGGGGAAGCGGAGTAAGGAGGGCG
ATGAAGGGATCAAACCAGCCGATACCCGGGCAGATGAAGACGAATGGCCA
TCCCTTATGATCGAAGTTGGTGTGTCTCAAACCATGCTATCCCTCCGCGA
GAGTGCTTGTTGGTGGTTAGAGAATTCCAAGGAAAGGACTCGAATGGTTA
TTT

Sequences in the Contig:

SY0AAA54YJ23FM1