Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YJ22FM1
Length(NT) : 431
Best Gene Model Blast : Link to GSTUMT00008611001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An14g06870
Accession: ref|XP_001401310.1| Score: 634 E_value: 7e-65
KEGG Definition: hypothetical protein
Accession: ang:An14g06870 Score: 634 E_value: 3e-65
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG1567 Score: 624 E_value: 3e-66
PFAM Definition: Ribonuc_red_sm, Ribonucleotide reductase, small chain..
Pfam Number: pfam00268 Score: 383 E_value: 3e-38
Swissprot: Q9C167|RIR2_NEUCR

Sequence:
>SY0AAA54YJ22FM1
TTGGGAAACGTGGATTGATGCCTGGCTTGTCATTCTCAAACGAGCTCATC
TCCCGCGACGAGGGCCTCCACACTGACTTCGCCTGTCTGTTGTTCAACCA
CTTGAACAACCGCCCTTCTCAACAGGCTGTTCAAGATATCATTGTCGAGG
CTGTTGGCATTGAGCAAGAATTCTTGACTGAAGCTCTTCCTTGTGCTCTT
TTGGGCATGAACTCTAAGCTCATGAAGCAGTATATTGAATTTGTTGCCGA
CCGTCTTCTGTTGTCTCTCGGTAACCCAAAGTTTTACAATGCCACTAACC
CATTCGACTTTATGGAGTCTATTTCTCTTGCCGGCAAAACCAACTTCTTC
GAGAAGCGTGTCGGAGACTATCAGAAAGCTGGTGTCATGGCGTCTACTCA
AAAGAAAACTGAGGAGCCCACCAACAATGGC

Sequences in the Contig:

SY0AAA54YJ22FM1