Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YG10FM1
Length(NT) : 382
Best Gene Model Blast : Link to GSTUMT00003197001 E-value : 1e-131
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05263
Accession: ref|XP_001245822.1| Score: 131 E_value: 2e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG09790.1 Score: 126 E_value: 3e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA54YG10FM1
TTGGGGAGAAAGAACTCAAGCAGGCCGAGAAAGAAATGGAAGAGGCCAAA
AAGCAAGGGAAGGAACTCGCTGCAGCAGCCGAGAACAGAATCGCCGAGGA
GGAGAAACATCTCCGAGCCATCGCTGCCGAAAAACTCAACCTTGCAGTTC
TGGCCGTTACCCCACCGCCACCGCCGATTCAACTAGAATACACAGACTAC
GACAGCATCTGGGACTTGCTGAGCGACAGTCGCGCCGATCAAGTTATCTA
TACAATGAGCAAGTTGGCGTGGGTTTCCATCTATCCGGGTAAGTACGTTT
TAAGTTGTGCCCGGAATGGATACATCACGGTGGAAAGGGACCATAGCGGG
TGGTACAAAGTGGAAGAATTCCGCGCTTTACC

Sequences in the Contig:

SY0AAA54YG10FM1