Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA54YE10FM1
Length(NT) : 210
Best Gene Model Blast : Link to GSTUMT00008626001 E-value : 1e-111
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat protein E2_5
Accession: gb|AAO25687.1| Score: 149 E_value: 1e-08
KEGG Definition: hypothetical protein
Accession: ani:AN1130.2 Score: 147 E_value: 1e-08
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 145 E_value: 7e-11
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 108 E_value: 1e-06
Swissprot: Q566C8|ANR54_RAT

Sequence:
>SY0AAA54YE10FM1
GTTGTCCCCCGAAGCCGCACGCAGCGGAAACTCTTCTGAAGTCCAACTCC
TGCTGGACGCTGGCCACTCCTGCAATGAAGAGAACTTCTTCGGGCAGACA
CCACTACACATAGCAGCGGCAAATGGCCATCACTGCGTCGTGCAAATCCT
CCTTGAGGCCGGCACCTGCGTTGACACGCTAGACAGCTACTCCTGGACCC
CTCTACAATG

Sequences in the Contig:

SY0AAA54YE10FM1