Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YP07FM1
Length(NT) : 508
Best Gene Model Blast : Link to GSTUMT00004016001 E-value : 1e-113
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001588182.1| Score: 177 E_value: 1e-21
KEGG Definition: hypothetical protein
Accession: ncr:NCU08954.1 Score: 142 E_value: 4e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YP07FM1
TTGGCACGAATTTCACACAAGGGCCTCATAATTTCCTGAACAACTACAAG
TACGCTGCAGCAATGTCCACCTCACCACAAAAAACGGAATGGCTCTGCAT
CTTGCCGGACCAGGTTAACGGCGGGCTGGAGAGGAGACTTAAAGTTCGCA
CGGAACATCTCGAGGGTATCAAAAGGAACCAAGAAGCCGGATTCGCCAAC
TTTGGCGGTTCGTTTCCCAGACCGCTCATGGGACATACGTGAGCGAGCGA
AGCTACTAATCTGTCCTGACAGGAGTGTTCCTCAACGAACCCGCGCAGGA
AGGGAAGGATCTCTCCTTCAGGGGATCTATCATTGTCGCTACAGGAGTGA
GTAAAGAGGCCGTCCTCGAGGTCCTGAAGCAGGATGTTTACTCCAAGAAT
GATGTGTGGGATTGGGAAAAGGCCGAGATCTATCCCTTCAAAACTGCAAT
TGCATCCCCACTTCCGTACGTTTAGGTTAGATAGCGATGGATGGGGGTGA
CTTGTCGT

Sequences in the Contig:

SY0AAA53YP07FM1