Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YP01FM1
Length(NT) : 478
Best Gene Model Blast : Link to GSTUMT00003449001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An16g03790
Accession: ref|XP_001397690.1| Score: 351 E_value: 5e-32
KEGG Definition: hypothetical protein
Accession: ang:An16g03790 Score: 351 E_value: 2e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1674 Score: 145 E_value: 2e-10
PFAM Definition: Cyclin, Cyclin. This family includes many different cyclin proteins. Members include the G1/S-specific cyclin pas1, and the phosphate system cyclin PHO80/PHO85..
Pfam Number: pfam08613 Score: 165 E_value: 6e-13
Swissprot: O14336|MUG80_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0016538 = Molecular function: cyclin-dependent protein kinase regulator activity
GO:0000079 = Biological process: regulation of cyclin-dependent protein kinase activity

Sequence:
>SY0AAA53YP01FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTTATCCTCAACACGGTTGCCAAGTTCAACCATTTTGCTAGGT
CTAGTTTATCTGCAGAGACGAATGGTCAATCCTACCCCTACCGCGTTGCG
GCATGATCACGTGTATCGAATGATTACAATCGCTCTTCTACTCGCAAGCA
AGTTTCTGGATGATAACACCTTCCAGAACAAGTCTTGGTCTGATGTCACA
GGTCTCCCTGTGGACGAACTCAACACTTTGGAGAAGGATTGGTTGAAGGA
GATAGGGTGGGATTTGCATGTTGATCCCGAGGGAACTAAAGGGTTCAGCC
AGTATACAACAATGTGGGAAACGTGGGTTAGGAAAAACGGGACAAAGGCG
GCCATTCCGGCGCTTGCACCCATCAACACTAATATTCGTCACCACCATCG
CACCGAGTCGACGTCATTCTCACCTTTG

Sequences in the Contig:

SY0AAA53YP01FM1