Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YM09FM1
Length(NT) : 578
Best Gene Model Blast : Link to GSTUMT00007221001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 385 E_value: 9e-36
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 379 E_value: 2e-35
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 235 E_value: 8e-21
PFAM Definition: No Hit Found
Swissprot: O15084|ANR28_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAA53YM09FM1
TTGGCAGAAAATGGCCCCACGGTTCCACAACAATGTCATCCCCTTTGGCA
CGCCCCGCCGAACACCACTTCAGTATGCTGTTATGAATGGGCACGAGGAT
GTGGTCCAACTACTACTTGGACGGCGAGATGTGAACCCCGATAAACCGGA
CCTGTTTGGCCAAACTCCACTCCATTTTGCTGCTGAGAACGGGTACGAGA
GAGTTGTGAAAATGCTACTCGGACGGGCCGAGGTCAACCCCGACAAGCCA
GGTAACTGGGGCCAAACACCTCTCTTCCGCGCTGCTATGCATGGGCACGA
GGAAGTGATGAGAATACTACTCGGACGAAGTGAGGTCAACCCTGACAAAC
CAGATAGCAACGGCAACACCCCACTTTTTATGGCCGCCTGGTACGGGAGA
GAGGGAGCAGTAAGAATGCTACTCGGACGCGACGACGTCAACCCCGAAAA
CCCCGATAAGAACGGCCGAACCGCACTCTGTGGTGCTGTGGAGAACTCGC
AGGAGGAAGTGGTGAAAATACTGCTCGGACGGGACGACGTCAACCCCAAC
GAACCCGATGATTTTGACCGGACACCAC

Sequences in the Contig:

SY0AAA53YM09FM1