Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YL20FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00001933001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_04644
Accession: ref|XP_001594836.1| Score: 202 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG09527.1 Score: 188 E_value: 4e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YL20FM1
TGTACAAAAAAGTTGGATGGGTTTGAGCTTGCGAGAAGGGGGATGACTAT
TCCGCGAGAGATCGAGGAACGACAGGCAAGCGTTATTGGGCATCTTGGGT
GTATCCGGGAGTTTGCTCTGTTGGTTGAGGATCTCAAACGATTGCGGGAT
ATCGGAAACGCTTCTGGTCTTAGGAATGGGGCTAATAAACATCTTTTGGA
GGAGGCTGATGGGATCATTGCATTGGCTACTCTTGATGACGAGGACACTC
TTCCTTCTGTTCAACCCGATAGGAGCCAAAACCGTTCTAGCTGGCATACA
CCTTCCAGACATTCTGAGATGACCTTTGACGATGATTTCAAGTCTACCCC
ACGTAATAGAAGGCGCTCGTCTATCCTGTTACCGGACGATGATGTATTCG
GTGGTGGCAACCTACCTACCACCCCTTCCTCATTCCCTCACCTGATGCAT
GGGTTCCGCAGTCCTTCTGCCTCTTCCTCGCCTTCGCCGTTATCCAAGAA
GTCTATCGATAAGAACGATCCTGTGGAGGTTGCTAAAGGGATCATGGAAC
GGATGCAGCTGCAGCATTGGCAAACGTCGGATCATCCCATTGGGTCGGGA
AAGTCGAAAGGTACTTGGAA

Sequences in the Contig:

SY0AAA53YL20FM1