Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YL02FM1
Length(NT) : 623
Best Gene Model Blast : Link to GSTUMT00001123001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212542.1| Score: 165 E_value: 3e-12
KEGG Definition: hypothetical protein
Accession: ang:An08g10070 Score: 164 E_value: 5e-12
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1002 Score: 116 E_value: 5e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YL02FM1
TTGGGCGGAGCTTTCCAATTGAATAAGGTTATCGATCTCAGAACCTTCCA
GAAAGTCCACATGTCTGAGGGAGAGGAAGCTGCGCCCGAGGAACCCGAGG
AGGAGTACGACGATGATCTCATTTACGACACGGATTCGTCTGAGGATAGT
GATGATGATGGCGATACAGGGAGTGATTTGGAGGGCTTTATCGTCAATGA
TGAGGAGGTGGATAGTGACGAACAGGGCGAGGGTAGCGCGACCGTAGGTG
CTTCCGAGGATGGGGGTCAGGCACCTGCGCGAAAGGCTGCTGCACCAAAG
AAAAAGAAGGACGTTAAGGGCAAGGGGAAGGCAAAGGAGAAGAGCCGTCC
AAGGACTCTGGCCGAAGTGCGCAAGGATGCTATGCGCAATGCCAAGAGCA
AGAAGCAGTGTATGTTTCCTCCCATCTTTTGCTCTTTAGCGATAGGCCAC
GACTGATGTATTTGGGGGTACAGATATGAAGCATCTTCAAAAACGCTGGA
TTAGCAGTGCCAAAGTCGACAAGTGCATGGAAATCCTCCAGACCATCCGC
GACAATGACGGGGTGGAGAAGACGATTGTCTTTTCCCAGTTCACCTCCCT
TCTAGACCTAATCGAGATCCCGA

Sequences in the Contig:

SY0AAA53YL02FM1