Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YK15FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00006815001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_00913
Accession: ref|XP_001220134.1| Score: 193 E_value: 2e-13
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00521 Score: 174 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YK15FM1
TTGGCAAGTGCAAGCGTTAAGGATGTCGTGAAGCTCGTGGAAGGTGACCC
CGAACACACGGTGCCCATTTTGTTTACTTCATCTGTCAACGGACAAGGGG
TTGACCTACTCCATGAGTTGATTATGAGACTTCCAGTACCTGAGCCCCCT
GAAGCACCGAGGGCGTTAAATGCTCTTGGGCCTTTGCTAGGCGCTAGCTC
GGTGGGTGTCAAGGAAGGGACGCAGAAGATCAGGGTAGATAAAGGAGAGC
CGAGGGTTGTAATGGAGGAAGACTGCGGATTGTCCACTTTGTTCCATCTC
GAGGAAATCTATGGATTTCAACCCGCGCATAGTGCAGAGGATGGGAATCG
GGGGGCTGTGGTTGGTGGGCATGTCAAGTATGGGAAAATCTCTATTGGTG
ATGAGTTGCTGGTTGGGCCCCTAACGCCTGTCGACCATACCAGCAACCCG
CCATCAGCCGAAGGGACTCCTGCTACTCCTGCCCCCCATCCTCTGCTATC
ACCATCTGTCGGCCATTTGCCGGGGCTCATGTCCAAGAGCCCAGACAGTG
CTAACGAGACGAGGGCCACCTCTCGTAAGCGATCCGGACTAAAAATCACA
CGTGGTGACGATACTGTGCATAGCAGTGCGTCTGGCGAGGACT

Sequences in the Contig:

SY0AAA53YK15FM1