Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YI19FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00006605001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 226 E_value: 3e-17
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 226 E_value: 2e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>SY0AAA53YI19FM1
TTGGCTCTTACCGTTACTCTACTCAAGAATTTCCACATCCCACTTGGTCT
ACCAGCACACGTGTCGCCAAACGAGAACAGCAAAATTCGTACGCTAGACA
AAAAATGAACCGAACATTACTTCAAAACTCAAGCGTGATCGGGAATATCG
TGAAAAGTTCCAACAATAAATTCAAAGAGTGTGCTACATCTATATCCGAA
GACAAAGGCCAAGTTCTGGAATGGCTATCTCCATGGATATCACGGGAGAG
GCATCATGCTGTCCGTGACTCACGGATGGAGGGAGTAGGGAACTGGCTGC
TTCGCGAAGCAAAGTTTTCTACATGGCATGCATTGGAGAACGCGAAGCCG
GTGCTATTATGTTACGGAGATCCGGGCGTCGGTAAGACGTATATCAGCTC
GCTTGTAATAGATACGCTTTCCAAAGGGACTTATGGAGAGCCTGTGGCCA
TCACTTATGTCTACTGCGACTTCACAGCTCGCGAGATGCAATCTGTTCGC
AATCTCTTAGGATCGGTGTTAAGGCAGGTTATAGCAGCAATGGCGGAGAC
CCCCAGTGAAATAGTTGGTGCGTTTGAGCATGCGAGGGAATACGCCGATG
GTTGTACGCTCCCGCCTTCCGAGATCCTGACGCTGCTCGT

Sequences in the Contig:

SY0AAA53YI19FM1